View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0526_low_65 (Length: 268)

Name: NF0526_low_65
Description: NF0526
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0526_low_65
NF0526_low_65
[»] chr2 (1 HSPs)
chr2 (47-227)||(18065612-18065789)


Alignment Details
Target: chr2 (Bit Score: 138; Significance: 3e-72; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 47 - 227
Target Start/End: Complemental strand, 18065789 - 18065612
Alignment:
47 ggttgattgaatcggagatctattcgatgnnnnnnncggaacttaataataatctacacgatcgtggtttctgagaagtgattaattttggaagcgattc 146  Q
    |||||||||||||||||||||||||||||       |||||||   ||||||||||||| |||||||||||||||||||||||| |||||||||||||||    
18065789 ggttgattgaatcggagatctattcgatgagaaaaacggaact---taataatctacacaatcgtggtttctgagaagtgattatttttggaagcgattc 18065693  T
147 tgcttttgatcgtttagcttgcttacgcggtaagcgttgaaacaacgaatcatccacgaaataattcgttttcatcttttc 227  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
18065692 tgcttttgatcgtttagcttgcttacgcggtaagcgttgaaacaacgaatcatccacgaaataattcgttttcatcttttc 18065612  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University