View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0526_low_76 (Length: 252)
Name: NF0526_low_76
Description: NF0526
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0526_low_76 |
 |  |
|
[»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 1 - 252
Target Start/End: Original strand, 7092835 - 7093090
Alignment:
Q |
1 |
ttatcgaaaaatttgcacgggtagcagacatatagatgagataacgtaaatgtaccgcatggtccactctccaacaattatacaactcatattcattcac |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
7092835 |
ttatcgaaaaatttgcacgggtagcagacatatagatgagataacgtaaatgtaccgcatggtccactctccaacaattatacaactcatattcattcac |
7092934 |
T |
 |
Q |
101 |
gatcacaagtat----cactatggcccagcagaaacatgttattcattcattgtcatttatttggtgtctatattttgtgaatattgtaccttgtttctt |
196 |
Q |
|
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
7092935 |
gatcacaagtatatatcactatggcccagcagaaacatgttattcattcattgtcatttatttggtgtctatattttgtgaatattgtaccttgtttctt |
7093034 |
T |
 |
Q |
197 |
aaacagatgggaagtgcaatcaattatggcgttctagttgttttttaacaaacaaa |
252 |
Q |
|
|
|||||||| |||| |||||||||||||||| ||||||||||||||||||||||||| |
|
|
T |
7093035 |
aaacagataggaaatgcaatcaattatggccttctagttgttttttaacaaacaaa |
7093090 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
© Oklahoma State University