View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0526_low_78 (Length: 251)
Name: NF0526_low_78
Description: NF0526
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0526_low_78 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 243; Significance: 1e-135; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 9 - 251
Target Start/End: Original strand, 11479238 - 11479480
Alignment:
| Q |
9 |
gaagaatatttaaattcccttcttttagtctgtttggtagactgtagcggatagcagacgaacttataactgacagcagataagcaagcatattgaagtt |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11479238 |
gaagaatatttaaattcccttcttttagtctgtttggtagactgtagcggatagcagacgaacttataactgacagcagataagcaagcatattgaagtt |
11479337 |
T |
 |
| Q |
109 |
gtagctcaaaaacggtataagtttgtgaaaaaacgctataagctcttaagagaaaactgttatcaaatagttctactttgattatatgagcttatatgct |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11479338 |
gtagctcaaaaacggtataagtttgtgaaaaaacgctataagctcttaagagaaaactgttatcaaatagttctactttgattatatgagcttatatgct |
11479437 |
T |
 |
| Q |
209 |
ataagatgtctgctataagctaacggttcagccttgccaaaca |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11479438 |
ataagatgtctgctataagctaacggttcagccttgccaaaca |
11479480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 180 - 226
Target Start/End: Original strand, 6036087 - 6036133
Alignment:
| Q |
180 |
tctactttgattatatgagcttatatgctataagatgtctgctataa |
226 |
Q |
| |
|
|||||||||| |||||||||||||||| ||||||| ||||||||||| |
|
|
| T |
6036087 |
tctactttgactatatgagcttatatgttataagaggtctgctataa |
6036133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University