View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0526_low_81 (Length: 251)
Name: NF0526_low_81
Description: NF0526
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0526_low_81 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 132; Significance: 1e-68; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 2 - 149
Target Start/End: Original strand, 13863802 - 13863949
Alignment:
| Q |
2 |
aaattcaataaaagagtatgattcaatttcttctttcgtatgaatttgaacagaatttcatgaactcaaaccaaaccaagttgagctacacatcctcacc |
101 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13863802 |
aaattcaataaaagggtatgattcaatttcttctttcgtatgaatttgaacagaatttcattaactcaaaccaaaccaagttgagctacacatcctcacc |
13863901 |
T |
|
| Q |
102 |
ttatagccatacaaattctctttaaacggtgtgggacttcagtctctg |
149 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
13863902 |
ttatagccctacaaattctctttaaacggtgtgggacttcagcctctg |
13863949 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1059 times since January 2019
Visitors: 3662