View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0526_low_82 (Length: 251)
Name: NF0526_low_82
Description: NF0526
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0526_low_82 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 9 - 247
Target Start/End: Complemental strand, 36747555 - 36747317
Alignment:
| Q |
9 |
gagatgaagataaggttttgcacttttgctttaacagcttagtttgacctaccatggggaatggacttgtttttataagagcaacttcaagtaatccaag |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36747555 |
gagatgaagataaggttttgcacttttgcttgaacagcttagtttgacctaccatggggaatggacttgtttttataagagcaacttcaagtaatccaag |
36747456 |
T |
 |
| Q |
109 |
taggatgtttgcggttcggtttagcactttagcttgtttggttatataaatatgaaccaattcaatctagttctcacaggagaacaggattaattgatat |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
36747455 |
taggatgtttgcggttcggtttagcactttagcttgtttggttatataaatatgaaccaattcaatctagttctcataggagaacaggattaattgatac |
36747356 |
T |
 |
| Q |
209 |
catgatgtcaaacttaaaaatacgacacatttcataatt |
247 |
Q |
| |
|
||| |||||||||||||||||| |||||||||||||||| |
|
|
| T |
36747355 |
cataatgtcaaacttaaaaatatgacacatttcataatt |
36747317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University