View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0526_low_85 (Length: 251)
Name: NF0526_low_85
Description: NF0526
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0526_low_85 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 93; Significance: 2e-45; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 142 - 242
Target Start/End: Complemental strand, 40738066 - 40737966
Alignment:
| Q |
142 |
gggggtttaaatttaataaattataaaaggagattgaagatgacactgaaactctattttggtgggacctgttgattgatggtatgatcttgaagaataa |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40738066 |
gggggtttaaatttaataaattataaaaggagattgaagatggcaccgaaactctattttggtgggacctgttgattgatggtatgatcttgaagaataa |
40737967 |
T |
|
| Q |
242 |
t |
242 |
Q |
| |
|
| |
|
|
| T |
40737966 |
t |
40737966 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 170 - 236
Target Start/End: Original strand, 6355601 - 6355667
Alignment:
| Q |
170 |
ggagattgaagatgacactgaaactctattttggtgggacctgttgattgatggtatgatcttgaag |
236 |
Q |
| |
|
|||||| | ||||| |||| ||||| ||||||||||||||| || |||||||||||||||||||||| |
|
|
| T |
6355601 |
ggagataggagatggcactaaaactttattttggtgggacccgtggattgatggtatgatcttgaag |
6355667 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 190 - 242
Target Start/End: Original strand, 23805617 - 23805669
Alignment:
| Q |
190 |
aaactctattttggtgggacctgttgattgatggtatgatcttgaagaataat |
242 |
Q |
| |
|
||||| ||||||||||||| ||| ||||||||||||||| ||||||| |||| |
|
|
| T |
23805617 |
aaactttattttggtgggatatgtggattgatggtatgatattgaagagtaat |
23805669 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 179 - 240
Target Start/End: Original strand, 26624821 - 26624882
Alignment:
| Q |
179 |
agatgacactgaaactctattttggtgggacctgttgattgatggtatgatcttgaagaata |
240 |
Q |
| |
|
||||| |||| ||||| ||||||||||| | | || |||||||||||||||||||||||||| |
|
|
| T |
26624821 |
agatggcactaaaactttattttggtggcatccgtggattgatggtatgatcttgaagaata |
26624882 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 587 times since January 2019
Visitors: 3653