View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0527_high_1 (Length: 410)
Name: NF0527_high_1
Description: NF0527
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0527_high_1 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 16 - 231
Target Start/End: Original strand, 16559383 - 16559598
Alignment:
| Q |
16 |
atattttggcttcaatactcttcttcggaccagaattaggtattcaaagccgatcataatattcatagacctaaatatcaagatcatagtattagcccat |
115 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||| |
|
|
| T |
16559383 |
atattatggcttcaatactcttcttcggaccagaattaggtattcaaagccgatcataatattcatagtcctaaatatcaagatcatagtatcagcccat |
16559482 |
T |
 |
| Q |
116 |
ttttgaaatcatgcggtagttctataaatgacaaccttttctttcaaaaaatggtgttgcttttgaaattaaatagagctctcactattggatgattgtt |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
16559483 |
ttttgaaatcatgcggtagttctataaatgacaaccttttctttcaaaaaatggtgttgcttttgaaattaaatagaactctcactattggatgattgtt |
16559582 |
T |
 |
| Q |
216 |
ttgttaattgatgcag |
231 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
16559583 |
ttgttaattgatgcag |
16559598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University