View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0527_high_11 (Length: 230)
Name: NF0527_high_11
Description: NF0527
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0527_high_11 |
 |  |
|
[»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 102; Significance: 8e-51; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 102; E-Value: 8e-51
Query Start/End: Original strand, 129 - 230
Target Start/End: Original strand, 34675188 - 34675289
Alignment:
Q |
129 |
catcatcaagctcatacaattcaccatgtgcagcctgcaaattccttcgtcgaaaatgcatgccaggctgcatctttgcaccatactttccaccggaaga |
228 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
34675188 |
catcatcaagctcatacaattcaccatgtgcagcctgcaaattccttcgtcgaaaatgcatgccaggctgcatctttgcaccatactttccaccggaaga |
34675287 |
T |
 |
Q |
229 |
ac |
230 |
Q |
|
|
|| |
|
|
T |
34675288 |
ac |
34675289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 48; Significance: 1e-18; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 129 - 216
Target Start/End: Original strand, 43583177 - 43583264
Alignment:
Q |
129 |
catcatcaagctcatacaattcaccatgtgcagcctgcaaattccttcgtcgaaaatgcatgccaggctgcatctttgcaccatactt |
216 |
Q |
|
|
||||||| ||||||||||||||||| ||||| |||||||||||| | | |||||||||||||||| |||||||||||||| ||||| |
|
|
T |
43583177 |
catcatccagctcatacaattcaccttgtgctgcctgcaaattcttgaggagaaaatgcatgccaggatgcatctttgcaccttactt |
43583264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 200 times since January 2019
Visitors: 3675