View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0527_high_5 (Length: 314)
Name: NF0527_high_5
Description: NF0527
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0527_high_5 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 269; Significance: 1e-150; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 269; E-Value: 1e-150
Query Start/End: Original strand, 30 - 302
Target Start/End: Original strand, 47387739 - 47388011
Alignment:
| Q |
30 |
tggactacacaagcacagcccctttcttctgatgatgatagtctgctgcagtggtctttttccgagaggttttctgacactagattttcggatcttggtt |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47387739 |
tggactacacaagcacagcccctttcttctgatgatgatagtctgctgcagtggtctttttccgagaggttttctgacactagattttcggatcttggtt |
47387838 |
T |
|
| Q |
130 |
tctcgcttattttgtatgcctggaagaacttgtaaagatgcagaaatccaccatatatttaatactaacagacatcttagtgagttttctatttatcaac |
229 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
47387839 |
tctcgcttattttgtatgcctggaagaacttgtaaagatgcagaaatccaccatatatttaatactaacagacatcttagtgagttttctattcatcaac |
47387938 |
T |
|
| Q |
230 |
catgtcactgaaatacagtcgacagaaaatgagtcctttagttttgtttctttcgatccacctgttaaattca |
302 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47387939 |
catgtcactgaaatacagtcgacagaaaatgagtcctttagttttgtttctttcgatccacctgttaaattca |
47388011 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1324 times since January 2019
Visitors: 3667