View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0527_high_9 (Length: 251)
Name: NF0527_high_9
Description: NF0527
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0527_high_9 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 1 - 244
Target Start/End: Original strand, 47388139 - 47388385
Alignment:
| Q |
1 |
tgctttttagcttattacatgtccattcttttgattagtatgtacatacatatta---attaataattatacacagctccgggttgtcgaatgttttaac |
97 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47388139 |
tgctttttagcttatcacatgtccattcttttgattagtatgtacatacatattagtaattaataattatacacagctccgggttgtcgaatgttttaac |
47388238 |
T |
|
| Q |
98 |
ttctagtgttgagaaatgagaatttatttgatcaaatatgtaatgtggatactccaaactgataatgcataattattacaaaattacttcaattataagc |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47388239 |
ttctagtgttgagaaatgagaatttatttgatcaaatatgtaatgtggatactccaaactgataatgcataattattacaaaattacttcaattataagc |
47388338 |
T |
|
| Q |
198 |
taaggggagctgaggttgaaggtcgcctaattacaatgtctctgctc |
244 |
Q |
| |
|
|||||||||||||| |||||||| |||||||||||||||| |||||| |
|
|
| T |
47388339 |
taaggggagctgagattgaaggttgcctaattacaatgtcactgctc |
47388385 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University