View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0527_low_13 (Length: 349)
Name: NF0527_low_13
Description: NF0527
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0527_low_13 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 27 - 270
Target Start/End: Original strand, 9884102 - 9884345
Alignment:
| Q |
27 |
gagatgaagttgttgtctgacgcacaaggtagtgtctccgtttctgattccagtggtaagatcgtgttgacagttgatgaatttgctgctctaagtggaa |
126 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
9884102 |
gagatgaagttgttgtctgacgcacaaggtagtgtctccgtttctgattccagtggtaagatcgtgttgacagttaatgaatttgctgctctaagtggaa |
9884201 |
T |
 |
| Q |
127 |
aaatcaatgaatgtgaagatttgattgagaggacagaaacaactgcaatggctcaggtggaagcaatcaacacaagaagaaatgaagtgaacaaaaaagt |
226 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9884202 |
aaatcaatgaatgtgaagatttgattgagaggacagaaacaactgcaatggctcaggtggaagcaatcaacacaagaagaaatgaagtgaacaaaaaagt |
9884301 |
T |
 |
| Q |
227 |
cgaagctaatcttcaagcaatcgaagaaataaaagcagcaacag |
270 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9884302 |
cgaagctaatcttcaagcaatcgaagaaataaaagcagcaacag |
9884345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University