View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0527_low_14 (Length: 320)
Name: NF0527_low_14
Description: NF0527
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0527_low_14 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 1 - 233
Target Start/End: Complemental strand, 5173792 - 5173560
Alignment:
| Q |
1 |
cgatttacaacgataaataattatgtgcataggcttttgacatgttgttacttgtcattatcctatagctaaaaatgctgctttcaaatttaagtttata |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5173792 |
cgatttacaacgataaataattatgtgcataggcttttgacatgttgttacttgtcattatcctatagctaaaaatgctgctttcaaatttaagtttata |
5173693 |
T |
|
| Q |
101 |
aatgatctacaattgaagttcaaaaggttcgtcatcc-aaatttagtgacacaattgagacatcaaatctattttttatcattagaaatctaactcaata |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
5173692 |
aatgatctacaattgaagttcaaaaggttcgtcatccaaaatttagtgacacaattgagacatcaaatcta-tttttatcattagaaatctaactcaata |
5173594 |
T |
|
| Q |
200 |
acccggaatttgcaaacatggtagcacaagcaac |
233 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
5173593 |
acccggaatttgcaaacatggtagcacaagcaac |
5173560 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 19 times since January 2019
Visitors: 3673