View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0527_low_23 (Length: 251)
Name: NF0527_low_23
Description: NF0527
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0527_low_23 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 175; Significance: 3e-94; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 175; E-Value: 3e-94
Query Start/End: Original strand, 1 - 240
Target Start/End: Complemental strand, 39040311 - 39040070
Alignment:
Q |
1 |
ttggggtatggtcaccacatacgttacaataataagaaatgagacaata--tgaagaaaagcagaaggtttggttgctgcctcatgtgtgatacctgcta |
98 |
Q |
|
|
||||||||||||||||||| ||||| ||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
T |
39040311 |
ttggggtatggtcaccacagacgttccaataatgagaaatgagacaataaatgaagaaaagcagaaggtttggttgctgcctcatgcgtgatacctgcta |
39040212 |
T |
 |
Q |
99 |
caagttacgcgtcacgcaacaaaggagaaattacaagtgttcaactactgcctcatgtgcaatacacataagttgttccagaagtatcggaaatgcgcgt |
198 |
Q |
|
|
||||||||||| |||||| ||| |||||||||| ||||||||||||||||||||||| |||||||||||| |||||||||||||| |||||||||| | |
|
|
T |
39040211 |
caagttacgcgccacgcaccaatggagaaattaaaagtgttcaactactgcctcatgcacaatacacataaactgttccagaagtattggaaatgcgcat |
39040112 |
T |
 |
Q |
199 |
ctatgaatagaaagaccctacctcgttggaaaaacactctct |
240 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
39040111 |
ctatgaatagaaagaccctacctcgttggaaaaacactctct |
39040070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1287 times since January 2019
Visitors: 3667