View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0527_low_26 (Length: 238)
Name: NF0527_low_26
Description: NF0527
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0527_low_26 |
 |  |
|
[»] chr3 (1 HSPs) |
 |  |
|
[»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 102; Significance: 9e-51; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 102; E-Value: 9e-51
Query Start/End: Original strand, 137 - 238
Target Start/End: Complemental strand, 34675366 - 34675265
Alignment:
Q |
137 |
gtgagggaggagttcgttgaggatctttgtgacgttgcttgcgccgaagatcttgtgaacgtttgcaaatttttgaggttcttccggtggaaagtatggt |
236 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
34675366 |
gtgagggaggagttcgttgaggatctttgtgacgttgcttgcgccgaagatcttgtgaacgtttgcaaatttttgaggttcttccggtggaaagtatggt |
34675267 |
T |
 |
Q |
237 |
gc |
238 |
Q |
|
|
|| |
|
|
T |
34675266 |
gc |
34675265 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 137 - 238
Target Start/End: Complemental strand, 43583355 - 43583254
Alignment:
Q |
137 |
gtgagggaggagttcgttgaggatctttgtgacgttgcttgcgccgaagatcttgtgaacgtttgcaaatttttgaggttcttccggtggaaagtatggt |
236 |
Q |
|
|
||||||||| ||||| ||||| | ||||||||| ||||| || || || || ||||| |||||||||||||||||||| ||||| || || ||||| ||| |
|
|
T |
43583355 |
gtgagggagaagttcattgagaagctttgtgacattgctagcaccaaatattttgtgcacgtttgcaaatttttgaggctcttctggagggaagtaaggt |
43583256 |
T |
 |
Q |
237 |
gc |
238 |
Q |
|
|
|| |
|
|
T |
43583255 |
gc |
43583254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 171 - 235
Target Start/End: Original strand, 12360773 - 12360837
Alignment:
Q |
171 |
ttgcttgcgccgaagatcttgtgaacgtttgcaaatttttgaggttcttccggtggaaagtatgg |
235 |
Q |
|
|
|||||||| || || || |||||||| |||||||||||||| |||||||| ||||| || ||||| |
|
|
T |
12360773 |
ttgcttgcaccaaatattttgtgaacatttgcaaatttttgtggttcttctggtgggaaatatgg |
12360837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University