View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0527_low_28 (Length: 219)
Name: NF0527_low_28
Description: NF0527
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0527_low_28 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 1 - 200
Target Start/End: Original strand, 34675167 - 34675366
Alignment:
| Q |
1 |
gtagcgcaggagaaaaaatggcatcatcaagctcatacaattcaccatgtgcagcctgcaaattccttcgtcgaaaatgcatgccaggctgcatctttgc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34675167 |
gtagcgcaggagaaaaaatggcatcatcaagctcatacaattcaccatgtgcagcctgcaaattccttcgtcgaaaatgcatgccaggctgcatctttgc |
34675266 |
T |
 |
| Q |
101 |
accatactttccaccggaagaacctcaaaaatttgcaaacgttcacaagatcttcggcgcaagcaacgtcacaaagatcctcaacgaactcctccctcac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34675267 |
accatactttccaccggaagaacctcaaaaatttgcaaacgttcacaagatcttcggcgcaagcaacgtcacaaagatcctcaacgaactcctccctcac |
34675366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 80; Significance: 1e-37; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 14 - 200
Target Start/End: Original strand, 43583166 - 43583355
Alignment:
| Q |
14 |
aaaaatggcatcatca---agctcatacaattcaccatgtgcagcctgcaaattccttcgtcgaaaatgcatgccaggctgcatctttgcaccatacttt |
110 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||| |||||||||||| | | |||||||||||||||| |||||||||||||| ||||| |
|
|
| T |
43583166 |
aaaaatggcatcatcatccagctcatacaattcaccttgtgctgcctgcaaattcttgaggagaaaatgcatgccaggatgcatctttgcaccttacttc |
43583265 |
T |
 |
| Q |
111 |
ccaccggaagaacctcaaaaatttgcaaacgttcacaagatcttcggcgcaagcaacgtcacaaagatcctcaacgaactcctccctcac |
200 |
Q |
| |
|
|| || ||||| |||||||||||||||||||| ||||| || || || || ||||| ||||||||| | ||||| ||||| ||||||||| |
|
|
| T |
43583266 |
cctccagaagagcctcaaaaatttgcaaacgtgcacaaaatatttggtgctagcaatgtcacaaagcttctcaatgaacttctccctcac |
43583355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 78 - 166
Target Start/End: Complemental strand, 12360861 - 12360773
Alignment:
| Q |
78 |
tgcatgccaggctgcatctttgcaccatactttccaccggaagaacctcaaaaatttgcaaacgttcacaagatcttcggcgcaagcaa |
166 |
Q |
| |
|
|||||||||| ||||| ||||| ||||| || ||||| |||||||| |||||||||||||| |||||||| || || || |||||||| |
|
|
| T |
12360861 |
tgcatgccagattgcatatttgctccatatttcccaccagaagaaccacaaaaatttgcaaatgttcacaaaatatttggtgcaagcaa |
12360773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University