View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0527_low_4 (Length: 516)
Name: NF0527_low_4
Description: NF0527
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0527_low_4 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 246 - 516
Target Start/End: Original strand, 34675014 - 34675289
Alignment:
| Q |
246 |
ttagatctgatatt---tatttgtgaccattgagttttgtaataacttttgaaactaaaactgattattacttgaaaacacgatgta--gaagggaaagt |
340 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
34675014 |
ttagatctgatattctttatttgtgaccattgagttttgtaataacttttgaaactaaa-ctgattattacttgaaaacacgatgtatagaagggaaagt |
34675112 |
T |
|
| Q |
341 |
tagaagataaatagattcatattttgtatgactcaatannnnnnn-attgctttgtagcgcaggagaaaaaatggcatcatcaagctcatacaattcacc |
439 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34675113 |
tagaagataaatagattcatattttgtatgactcaatattttttttattgctttgtagcgcaggagaaaaaatggcatcatcaagctcatacaattcacc |
34675212 |
T |
|
| Q |
440 |
atgtgcagcctgcaaattccttcgtcgaaaatgcatgccaggctgcatctttgcaccatactttccaccggaagaac |
516 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34675213 |
atgtgcagcctgcaaattccttcgtcgaaaatgcatgccaggctgcatctttgcaccatactttccaccggaagaac |
34675289 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 49; Significance: 8e-19; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 407 - 502
Target Start/End: Original strand, 43583166 - 43583264
Alignment:
| Q |
407 |
aaaaatggcatcatca---agctcatacaattcaccatgtgcagcctgcaaattccttcgtcgaaaatgcatgccaggctgcatctttgcaccatactt |
502 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||| |||||||||||| | | |||||||||||||||| |||||||||||||| ||||| |
|
|
| T |
43583166 |
aaaaatggcatcatcatccagctcatacaattcaccttgtgctgcctgcaaattcttgaggagaaaatgcatgccaggatgcatctttgcaccttactt |
43583264 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 949 times since January 2019
Visitors: 3660