View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0529_high_22 (Length: 344)
Name: NF0529_high_22
Description: NF0529
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0529_high_22 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 1 - 258
Target Start/End: Original strand, 54724645 - 54724900
Alignment:
| Q |
1 |
agcccatggtataagaagggcttggcaagtttatcacggtagttttgatttttgtcatcatgtttatgctgttggtaattccttgtgatccaattccact |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54724645 |
agcccatggtataagaagggcttggcaagtttatcacggtagttttgatttttgtcatcatgtttatgctgttggtaattccttgtgatccaattccact |
54724744 |
T |
|
| Q |
101 |
gtcttttataccctgtcaataggaaaacatttgatagtatgagacatgtttttgctttgtgatatataaatgnnnnnnnnnnnnnnnnnnattattttcg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
54724745 |
gtcttttataccctgtcaataggaaaacatttgatagtatgagacatgtttttgctttgtgatatataaatg--tttttgtttgttttttattattttcg |
54724842 |
T |
|
| Q |
201 |
aaattgtatcaaataaataacatgtgcgtatttgatattaagatggttttgccagaat |
258 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
54724843 |
aaattgtatcaaataaataacatgtgcatatttgatattaagatggttttgccagaat |
54724900 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 938 times since January 2019
Visitors: 3660