View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0529_high_29 (Length: 304)
Name: NF0529_high_29
Description: NF0529
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0529_high_29 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 178; Significance: 5e-96; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 178; E-Value: 5e-96
Query Start/End: Original strand, 100 - 289
Target Start/End: Original strand, 2920473 - 2920662
Alignment:
Q |
100 |
gcaggcatggtcaaacgggaggctgcattcgccgtttcatcgggtgatgatgaatgggaatgaggcacgatattcaaccgggttgttctctatcccgaaa |
199 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||| ||||||||||||||||| |
|
|
T |
2920473 |
gcaggcatggtcaaacgggaggctgcattcgccgtttcatcgggtgatgatgagtgggaacgaggcacgatattcaaccgggctgttctctatcccgaaa |
2920572 |
T |
 |
Q |
200 |
ggagggtacattataaaagctccggaggagcttgtggatgaggaacaccctttgctctttaggccttatgatcatgttgaattcctcaag |
289 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
2920573 |
ggagggtacattataaaagctccggaggagcttgtggatgaggaacaccctttgctctttaggccttatgatcatgttgaattcctcaag |
2920662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 116; E-Value: 5e-59
Query Start/End: Original strand, 102 - 289
Target Start/End: Original strand, 2935323 - 2935510
Alignment:
Q |
102 |
aggcatggtcaaacgggaggctgcattcgccgtttcatcgggtgatgatgaatgggaatgaggcacgatattcaaccgggttgttctctatcccgaaagg |
201 |
Q |
|
|
|||||||||||||||||||| |||||||||| ||||| |||||||||||| ||||||||||||| |||||||| | ||||||||||||| ||| ||||| |
|
|
T |
2935323 |
aggcatggtcaaacgggaggttgcattcgccatttcacagggtgatgatgagtgggaatgaggcaagatattcagcagggttgttctctacccccaaagg |
2935422 |
T |
 |
Q |
202 |
agggtacattataaaagctccggaggagcttgtggatgaggaacaccctttgctctttaggccttatgatcatgttgaattcctcaag |
289 |
Q |
|
|
|||||||||||||||||||||||||||||| ||||| ||||| |||||||||||||||| ||||| |||||| | ||| ||||||||| |
|
|
T |
2935423 |
agggtacattataaaagctccggaggagctggtggacgaggagcaccctttgctctttaagccttttgatcaagctgagttcctcaag |
2935510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 489 times since January 2019
Visitors: 3651