View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0529_high_31 (Length: 277)
Name: NF0529_high_31
Description: NF0529
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0529_high_31 |
 |  |
|
[»] scaffold0087 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr4 (Bit Score: 42; Significance: 0.000000000000007; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 223 - 268
Target Start/End: Complemental strand, 42714154 - 42714109
Alignment:
Q |
223 |
gttggaaaatgttaattcagaacttttacaacctacatagtataat |
268 |
Q |
|
|
||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
T |
42714154 |
gttggaaaatgttaatttagaacttttacaacctacatagtataat |
42714109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 35 - 72
Target Start/End: Original strand, 29192536 - 29192573
Alignment:
Q |
35 |
tagagtagtgatatttgtatatctctttcttacaactt |
72 |
Q |
|
|
||||||||||||||||||| |||||||||||||||||| |
|
|
T |
29192536 |
tagagtagtgatatttgtacatctctttcttacaactt |
29192573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 34 - 72
Target Start/End: Complemental strand, 51487931 - 51487893
Alignment:
Q |
34 |
ttagagtagtgatatttgtatatctctttcttacaactt |
72 |
Q |
|
|
|||||| ||||||||||||| |||||||||||||||||| |
|
|
T |
51487931 |
ttagagaagtgatatttgtacatctctttcttacaactt |
51487893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0087 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: scaffold0087
Description:
Target: scaffold0087; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 36 - 72
Target Start/End: Original strand, 26950 - 26986
Alignment:
Q |
36 |
agagtagtgatatttgtatatctctttcttacaactt |
72 |
Q |
|
|
|||||||||||||||||| |||||||||||| ||||| |
|
|
T |
26950 |
agagtagtgatatttgtacatctctttcttataactt |
26986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 36 - 72
Target Start/End: Original strand, 15182471 - 15182507
Alignment:
Q |
36 |
agagtagtgatatttgtatatctctttcttacaactt |
72 |
Q |
|
|
|||||||||||||||||| ||||||||||| |||||| |
|
|
T |
15182471 |
agagtagtgatatttgtacatctctttctttcaactt |
15182507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 558 times since January 2019
Visitors: 3653