View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0529_high_40 (Length: 257)
Name: NF0529_high_40
Description: NF0529
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0529_high_40 |
 | |
|
| [»] chr4 (3 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 198; Significance: 1e-108; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 12 - 257
Target Start/End: Complemental strand, 2920896 - 2920651
Alignment:
| Q |
12 |
atgaacacaaagcatagtagttttatatttgatcacacaacacaatatttcatacaaagccaatcaatgcaaacaacatatagctcaagataaatttttt |
111 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| |||||| |||||||||||| ||| |||||||||||||||||||||||| |||| | ||| |
|
|
| T |
2920896 |
atgaacacaaagcatagtaattttatatttgatcacacaatacaatacttcatacaaagctaatgaatgcaaacaacatatagctcaagttaaaatgttt |
2920797 |
T |
|
| Q |
112 |
gaagaacacttgaacacacaacatatatatttatgttccacccgcttaataatattattccataagctagctcaaacgccacaataagtgcgcatagcaa |
211 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2920796 |
ggagaacacttgaacacacaacatatatatttatggtccaccctcttaataatattattccataagctagctcaaacgccacaataagtgcgcatagcaa |
2920697 |
T |
|
| Q |
212 |
attggtctctttggcctttttcagtgtaataatacttgaggaattc |
257 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2920696 |
attggtccctttggcctttttcagtgtaataatacttgaggaattc |
2920651 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 14 - 93
Target Start/End: Complemental strand, 2935842 - 2935766
Alignment:
| Q |
14 |
gaacacaaagcatagtagttttatatttgatcacacaaca-caatatttcatacaaagccaatcaatgcaaacaacatata |
93 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||| ||| ||||||| ||||| ||||||||||||| |
|
|
| T |
2935842 |
gaacacaaagcatagtagttttatatttgatcacacaacaccaatacttcttacaaag----tcaatacaaacaacatata |
2935766 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 114 - 146
Target Start/End: Complemental strand, 2935730 - 2935698
Alignment:
| Q |
114 |
agaacacttgaacacacaacatatatatttatg |
146 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |
|
|
| T |
2935730 |
agaacacttgaacacacaccatatatatttatg |
2935698 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1774 times since January 2019
Visitors: 3673