View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0529_high_53 (Length: 240)
Name: NF0529_high_53
Description: NF0529
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0529_high_53 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 158; Significance: 3e-84; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 30 - 199
Target Start/End: Complemental strand, 44689787 - 44689618
Alignment:
Q |
30 |
ttttgtttggtacaaaatgacctgcattattggctattcattctttcaataaaaatttgttgctatgactaagtaaaagatgttggtttaatacaattgg |
129 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
44689787 |
ttttgtttggtacaaaatgacctgcattattggctattcattctttcagtaaaaatttgttgctatgactaagtaaaagatgttggtttaatacaattgg |
44689688 |
T |
 |
Q |
130 |
ttttgtagcttttgcgatagaactgacagcttttgtcaatgcccgaatgtggcggggcaaaaatagtgtt |
199 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||| |
|
|
T |
44689687 |
ttttgtagcttttgcgatagaactgacagcttttgtcaatgcccgaatgtggcgggacaagaatagtgtt |
44689618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 30 - 164
Target Start/End: Complemental strand, 44680524 - 44680390
Alignment:
Q |
30 |
ttttgtttggtacaaaatgac---ctgcattattggctattcattctttcaataaaaatttgttgctatgactaagtaaaagatgttggtttaatacaat |
126 |
Q |
|
|
|||||||||||||||||||| |||||||||||||| ||||||||| || ||||||| ||||| ||||||||||||||||||||||||| ||||| |
|
|
T |
44680524 |
ttttgtttggtacaaaatgattttctgcattattggctcctcattcttt-aagcaaaattt--tgctaggactaagtaaaagatgttggtttaacacaat |
44680428 |
T |
 |
Q |
127 |
tggttttgtagcttttgcgatagaactgacagcttttg |
164 |
Q |
|
|
|||||||||||||||||| ||||||| |||||||||| |
|
|
T |
44680427 |
tggttttgtagcttttgcaatagaaccaacagcttttg |
44680390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University