View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0529_high_55 (Length: 222)
Name: NF0529_high_55
Description: NF0529
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0529_high_55 |
 |  |
|
[»] chr2 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 184; Significance: 1e-100; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 184; E-Value: 1e-100
Query Start/End: Original strand, 19 - 222
Target Start/End: Original strand, 16309871 - 16310074
Alignment:
Q |
19 |
tatgagtattgacgtggcaatatattaccggatacatgtataaaaaataattgtattaattaattaaatatgcgtcacaatatacatacatttggaatga |
118 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
16309871 |
tatgagtattgacgtggcaatatattaccggatacatgtataaaaaataattgtattaattaattaaatatgcgtcacaatatacatacatttggaatga |
16309970 |
T |
 |
Q |
119 |
tattgaggtcattagaaaagttttagaagagtccccgtgagcatattggtagagacatgcattgttatttgcaggattcgggtttgaacctatgctactc |
218 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||| || |||| |
|
|
T |
16309971 |
tattgaggtcattagaaaagttttagaagagtccccgtgagcatattggtagagacatgcattgttatttgcaggatttggatttgaacctctgacactc |
16310070 |
T |
 |
Q |
219 |
cact |
222 |
Q |
|
|
|||| |
|
|
T |
16310071 |
cact |
16310074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 149 - 193
Target Start/End: Original strand, 10602005 - 10602049
Alignment:
Q |
149 |
gtccccgtgagcatattggtagagacatgcattgttatttgcagg |
193 |
Q |
|
|
||||| |||||||| |||| |||||||||||||||||| |||||| |
|
|
T |
10602005 |
gtccctgtgagcatgttggcagagacatgcattgttatatgcagg |
10602049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University