View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0529_high_59 (Length: 211)

Name: NF0529_high_59
Description: NF0529
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0529_high_59
NF0529_high_59
[»] chr5 (1 HSPs)
chr5 (20-108)||(15085774-15085865)


Alignment Details
Target: chr5 (Bit Score: 54; Significance: 3e-22; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 20 - 108
Target Start/End: Original strand, 15085774 - 15085865
Alignment:
20 aacgttacaaagtagaagaaagaaagaaagnnnnnnnn---gtgcggtggcgttaagttcttttcttcccccgaaattcacacaacacaaca 108  Q
    ||||||||||||||||||||||||||||||           |||||||||||||||||||||||||||||||||||||||||||||||||||    
15085774 aacgttacaaagtagaagaaagaaagaaagaaagaaaaaaagtgcggtggcgttaagttcttttcttcccccgaaattcacacaacacaaca 15085865  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 322 times since January 2019
Visitors: 3649