View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0529_high_61 (Length: 208)
Name: NF0529_high_61
Description: NF0529
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0529_high_61 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 22 - 193
Target Start/End: Original strand, 56199961 - 56200132
Alignment:
| Q |
22 |
aagcatttgtgtgcttctgtcgtaaattgttgcgattctgattcgttaaatcaacaacctattggtttacaaaatccacaacttcttgcaagagagaccg |
121 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56199961 |
aagcatttgtgtgcttctgtcataaattgttgcgattctgattcgttaaatcaacaacctattggtttacaaaatccacaacttcttgcaagagagaccg |
56200060 |
T |
|
| Q |
122 |
tgtttagtgtaagtgagattgaagcactttatgaacttttcaagaagatcagcagtgcagtcattgatgatg |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56200061 |
tgtttagtgtaagtgagattgaagcactttatgaacttttcaagaagatcagcagtgcagtcattgatgatg |
56200132 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 125 - 193
Target Start/End: Original strand, 42160833 - 42160901
Alignment:
| Q |
125 |
ttagtgtaagtgagattgaagcactttatgaacttttcaagaagatcagcagtgcagtcattgatgatg |
193 |
Q |
| |
|
||||||||||||| |||||||| |||||||| || || || |||||||||||||| || |||||||||| |
|
|
| T |
42160833 |
ttagtgtaagtgaaattgaagctctttatgagctctttaaaaagatcagcagtgcggtgattgatgatg |
42160901 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 127 - 193
Target Start/End: Original strand, 24091586 - 24091652
Alignment:
| Q |
127 |
agtgtaagtgagattgaagcactttatgaacttttcaagaagatcagcagtgcagtcattgatgatg |
193 |
Q |
| |
|
||||| ||||| || |||||||| ||||| || ||||| |||||||||||||| || |||||||||| |
|
|
| T |
24091586 |
agtgttagtgaaatagaagcactgtatgagctcttcaaaaagatcagcagtgctgtaattgatgatg |
24091652 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 330 times since January 2019
Visitors: 3649