View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0529_low_20 (Length: 412)
Name: NF0529_low_20
Description: NF0529
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0529_low_20 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 317; Significance: 1e-179; HSPs: 4)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 317; E-Value: 1e-179
Query Start/End: Original strand, 16 - 356
Target Start/End: Complemental strand, 23332935 - 23332595
Alignment:
| Q |
16 |
gttgccatcgtgtttcgccaaggaatatggtgtgcatgttgatgattatgtcatgttgcgtgatccaaacagaaacatgttcgaggtcaaggtccacgtg |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
23332935 |
gttgccatcgtgtttcgccaaggaatatggtttgcatgttgatgattatgtcatgttgcgtgatccaaacagaaacatgttcaaggtcaaggtccacgtg |
23332836 |
T |
|
| Q |
116 |
aaaaatggcaaggtctatctgcgggatggttgggctgagctgaagggtttctataaggtagatcgtggtgcgtgggtcaccctgacttatgtacagccga |
215 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
23332835 |
aaaaatggcaaggtttatctgcgggatggttgggctgagctgaagggtttctataaggtagatcgtggtgcgtgggtcaccctgacgtatgtacagccga |
23332736 |
T |
|
| Q |
216 |
atcttctagatatgactatcgcagagagatcaggagtcgaaatcaactatcctaacaaatttcttcctcccatgtcgaaaatgattgtccaacgtgaggg |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
23332735 |
atcttctagatatgactatcgcagagagatcaggagtcgaaatcaactatcctaacaaatttcttcctcccatgtcgaaaatgattgtcccacgtgaggg |
23332636 |
T |
|
| Q |
316 |
tggatcggtcatgcgcttctatcgctcattcgtccacatat |
356 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
23332635 |
tggatcggtcatgcgcttctatcgctcattcgtccatatat |
23332595 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 35 - 129
Target Start/End: Original strand, 10955074 - 10955166
Alignment:
| Q |
35 |
aaggaatatggtgtgcatgttgatgattatgtcatgttgcgtgatccaaacagaaacatgttcgaggtcaaggtccacgtgaaaaatggcaaggt |
129 |
Q |
| |
|
|||||||||||| |||| |||||||| |||||||| |||||||||| |||| |||||||||||||| ||||||||| ||| || |||||||| |
|
|
| T |
10955074 |
aaggaatatggtttgcacgttgatgactatgtcat--tgcgtgatcctaacaagaacatgttcgaggttaaggtccacaagaagaagggcaaggt |
10955166 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 351 - 393
Target Start/End: Complemental strand, 23322373 - 23322331
Alignment:
| Q |
351 |
acatatgcgtttggattttacaacgattgtgtttgatgatgtc |
393 |
Q |
| |
|
||||||||||||||| ||||||||| ||||||||| ||||||| |
|
|
| T |
23322373 |
acatatgcgtttggagtttacaacgtttgtgtttggtgatgtc |
23322331 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 351 - 393
Target Start/End: Complemental strand, 23332540 - 23332498
Alignment:
| Q |
351 |
acatatgcgtttggattttacaacgattgtgtttgatgatgtc |
393 |
Q |
| |
|
||||||||||||||| ||||||||| ||||||||| ||||||| |
|
|
| T |
23332540 |
acatatgcgtttggagtttacaacgtttgtgtttggtgatgtc |
23332498 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 32; Significance: 0.000000009; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 62 - 129
Target Start/End: Complemental strand, 2027759 - 2027692
Alignment:
| Q |
62 |
tatgtcatgttgcgtgatccaaacagaaacatgttcgaggtcaaggtccacgtgaaaaatggcaaggt |
129 |
Q |
| |
|
|||||||| |||||||||||||||| |||||||| ||||| || || ||| ||||||||||||||| |
|
|
| T |
2027759 |
tatgtcattttgcgtgatccaaacaagaacatgtttgaggttaaagttcacaagaaaaatggcaaggt |
2027692 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 575 times since January 2019
Visitors: 3653