View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0529_low_21 (Length: 411)
Name: NF0529_low_21
Description: NF0529
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0529_low_21 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 266; Significance: 1e-148; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 266; E-Value: 1e-148
Query Start/End: Original strand, 1 - 266
Target Start/End: Complemental strand, 27863384 - 27863119
Alignment:
Q |
1 |
aggaggtggatgactagggtgcatgtaatacggtacttgaggtggctgcataggataaccaccaccatgattcatattcatatacccattattctccata |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
27863384 |
aggaggtggatgactagggtgcatgtaatacggtacttgaggtggctgcataggataaccaccaccatgattcatattcatatacccattattctccata |
27863285 |
T |
 |
Q |
101 |
taatgttgattattatcataaccaccaccataaccagattgatgatgaaattgatccataccagcataattactactttgaccttcataataatacatcg |
200 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
27863284 |
taatgttgattattatcataaccaccaccataaccagattgatgatgaaattgatccataccagcataattactactttgaccttcataataatacatcg |
27863185 |
T |
 |
Q |
201 |
gagcttgtatcggatactgatactccattttattaacctccaccttcgccgcatctccaccgtcca |
266 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
27863184 |
gagcttgtatcggatactgatactccattttattaacctccaccttcgccgcatctccaccgtcca |
27863119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 827 times since January 2019
Visitors: 3657