View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0529_low_23 (Length: 387)
Name: NF0529_low_23
Description: NF0529
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0529_low_23 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 215; Significance: 1e-118; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 74 - 353
Target Start/End: Original strand, 42600288 - 42600573
Alignment:
| Q |
74 |
aggagttgacatttctaaggtggctttgttaccacttgatagacttttagaatgtatgtcaata------gaaaagagcacaggtggtttaagttttgat |
167 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||| ||||||| |
|
|
| T |
42600288 |
aggagttgacatttctaaggtggctttgttaccacttgatagacttttagaatgtatgtcaataagaatagaaaagaacacaggtggtttaaattttgat |
42600387 |
T |
 |
| Q |
168 |
atgaatgagacaatatttgcatgaagtaaagtttatatttcaaatatgcatacgtaatgtgttgctattgtgatatttaaggcatcattcatctctcttg |
267 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
42600388 |
ctgaatgagacaatatttgcatgaagtaaagtttagatttcaaatatgcatacttaatgtgt--ctattgtgatatttaaggcatcattcatctctcttg |
42600485 |
T |
 |
| Q |
268 |
cctcttgccctcgg--tatatgtatcggaccataaagggagtcaaaaatgatttcagatacataaaattaattttcacatgtttaagt |
353 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42600486 |
cctcttgccctcggtatatatgtatcggaccataaagggaaccaaaaatgatttcagatacataaaattaattttcacatgtttaagt |
42600573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 69; E-Value: 7e-31
Query Start/End: Original strand, 13 - 89
Target Start/End: Original strand, 42600195 - 42600271
Alignment:
| Q |
13 |
aatatctttggctatcatgcaattcaacccagttacgccaatctctttcagaagtagtagtaggagttgacatttct |
89 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
42600195 |
aatatctttggctatcatgcaattcaacccaattacgccaatctctttcagaagtagtagtaggtgttgacatttct |
42600271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University