View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0529_low_25 (Length: 374)
Name: NF0529_low_25
Description: NF0529
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0529_low_25 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 161; Significance: 9e-86; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 161; E-Value: 9e-86
Query Start/End: Original strand, 86 - 258
Target Start/End: Original strand, 627041 - 627213
Alignment:
Q |
86 |
cagagagcaatgcaccaaaaactataacgaactaatgacttgaactatcaaaacatcaggacaccactaactatctcgtgtagttctgatctcttaacag |
185 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| || |
|
|
T |
627041 |
cagagagcaatgcaccaaaaactataacgaactaatgacttgaactatcaaaacatcaggacaccacttactatctcgtgtagttctgatctcttaatag |
627140 |
T |
 |
Q |
186 |
tccttgtcattagtccgttattgtttctggtgctcgaaaaattcctcgtcaatttgaaaagaaatgaagaagg |
258 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
T |
627141 |
tccttgtcattagtccgttattgtttctggtgctcgaaaaattcctcgacaatttgaaaagaaatgaagaagg |
627213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1273 times since January 2019
Visitors: 3643