View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0529_low_29 (Length: 358)
Name: NF0529_low_29
Description: NF0529
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0529_low_29 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 166; Significance: 9e-89; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 166; E-Value: 9e-89
Query Start/End: Original strand, 1 - 239
Target Start/End: Original strand, 42873191 - 42873432
Alignment:
| Q |
1 |
agaatccaagacaaatatatactatataattgtatcaacgggctcgcaaaattgtactgtgcaaaataattttgactgctagcacatttaaaaatagaga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42873191 |
agaatccaagacaaatatatactatataattgtatcaacgggctcgcaaaattgtactgtgcaaaataattttgactgctagcacatttaaaaatagaga |
42873290 |
T |
 |
| Q |
101 |
tttttaaatcattgttg----ataatatgaaaagtaatcatggttatgtatagagttatg-nnnnnnnnnngggtacaatgtatggagttgtgttatttt |
195 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||| |
|
|
| T |
42873291 |
tttttaaatcattgttgatatataatatgaaaagtaatcatggttatgtat--agttatgttttttttttttggtacaatgtatggagttgtgttatttt |
42873388 |
T |
 |
| Q |
196 |
taaaccaaaatttatacaaacagatatgacacggtataactcta |
239 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
42873389 |
caaaccaaaatttatacaaacagatatgatacggtataactcta |
42873432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University