View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0529_low_36 (Length: 342)
Name: NF0529_low_36
Description: NF0529
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0529_low_36 |
 |  |
|
[»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 87 - 342
Target Start/End: Complemental strand, 26755737 - 26755482
Alignment:
Q |
87 |
aagggcaggaaatttggctttcttgggttaatctttctcatttcctcaacatcttgcataggtctcttgttcatagttggccattgccacttattgcttg |
186 |
Q |
|
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
26755737 |
aagggcaggaaatttggctttcttgggttgatctttctcatttcctcaacatcttgcataggtctcttgttcatagttggccattgccacttattgcttg |
26755638 |
T |
 |
Q |
187 |
tgtttcgctcttcaccacctatgcagcttttagtctggaacatagtagcagcaacttgatcttcctccagtaatagctggtccggaaaaataatggtgat |
286 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
26755637 |
tgtttcgctcttcaccacctatgcagcttttagtctggaacatagtagcagcaaattgatcttcctccagtaatagctggtccggaaaaataatggtgat |
26755538 |
T |
 |
Q |
287 |
ctcttcgggcacatcagttgagggaatttggttcctttggtgaatttctgtgtcct |
342 |
Q |
|
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
26755537 |
ctcttcaggcacatcagttgagggaatttggttcctttggtgaatttctgtgtcct |
26755482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University