View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0529_low_38 (Length: 339)
Name: NF0529_low_38
Description: NF0529
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0529_low_38 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 90; Significance: 2e-43; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 30 - 156
Target Start/End: Original strand, 22959303 - 22959424
Alignment:
| Q |
30 |
gaaattcataattagatcaagtaatccaaattggtaagttttattttgaccgaatctaaaatagtagttagaaaaatttgaaagagaaatgtatttaaat |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||| |||| ||||||| ||||||||||||||||||||| |
|
|
| T |
22959303 |
gaaattcataattagatcaagtaatccaaactggta-gttttattttgaccgaatctaaaatggtag----aaaaattcgaaagagaaatgtatttaaat |
22959397 |
T |
|
| Q |
130 |
aaaatatatcatactaataaaggaacc |
156 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
22959398 |
aaaatatatcatactaataaaggaacc |
22959424 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 217 - 325
Target Start/End: Original strand, 22959541 - 22959649
Alignment:
| Q |
217 |
ataattatattcaaaatatagcaattaacgttaatttaacggtaatatattgatgattcataactcttaattatgattttagaaatcatcgaaaaattca |
316 |
Q |
| |
|
|||||| ||||||| |||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
22959541 |
ataattctattcaatatatagcaattaacgttaatttaacggtgatatattgatgattgataactcttaattatgattttagaaatcatcgataaattca |
22959640 |
T |
|
| Q |
317 |
aaggcaaca |
325 |
Q |
| |
|
||| ||||| |
|
|
| T |
22959641 |
aagtcaaca |
22959649 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1094 times since January 2019
Visitors: 3663