View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0529_low_43 (Length: 323)
Name: NF0529_low_43
Description: NF0529
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0529_low_43 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 12 - 272
Target Start/End: Original strand, 2435466 - 2435726
Alignment:
| Q |
12 |
cagaacctgtgaaaactactaattataaccacaaattgtcaagagaaatctagtttataaggaatttgacggtttccttaattttaagtctgactacatt |
111 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
2435466 |
cagaacctatgaaaactactaattataaccacaaattgtcaagagaaatctagtttataaggaatttgacgatttccttaattttaagtctgactacatt |
2435565 |
T |
 |
| Q |
112 |
ctatgccatgtttggaaacacattggaagtttaccttttaaatcaaggatatggtctccaacttctcaactcaatcagtaaaaccacttttacaatcatc |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2435566 |
ctatgccatgtttggaaacacattggaagtttaccttttaaatcaaggatatggtctccaacttctcaactcaatcagtaaaaccacttttacaatcatc |
2435665 |
T |
 |
| Q |
212 |
ttgggctctacgcaacctaactttactcnnnnnnnnggaagcaacctaacatagatctctg |
272 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
2435666 |
ttgggctctacgcaacctaactttactcaaaaaaaaggaagcaacctaacatagatctctg |
2435726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University