View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0529_low_44 (Length: 322)
Name: NF0529_low_44
Description: NF0529
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0529_low_44 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 97; Significance: 1e-47; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 127 - 235
Target Start/End: Original strand, 6118678 - 6118786
Alignment:
Q |
127 |
agaacttctatatcattttcgttctactgtctagcttttatatcactattctacgcagaactgaagtaggactagttcgatggcagcacattctaagatt |
226 |
Q |
|
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
6118678 |
agaactttcatatcattttcgttctactgtctagcttttatatcactattctacacagaactgaagtaggactagttcgatggcagcacattctaagatt |
6118777 |
T |
 |
Q |
227 |
tgcaagaat |
235 |
Q |
|
|
||||||||| |
|
|
T |
6118778 |
tgcaagaat |
6118786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 29 - 75
Target Start/End: Original strand, 6118581 - 6118627
Alignment:
Q |
29 |
ctgtgtttgcaattacaagttctaactcgattattatttattgaaca |
75 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
6118581 |
ctgtgtttgcaattacaagttctaactcgattattatttattgaaca |
6118627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 693 times since January 2019
Visitors: 3655