View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0529_low_49 (Length: 301)
Name: NF0529_low_49
Description: NF0529
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0529_low_49 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 234
Target Start/End: Complemental strand, 30319730 - 30319501
Alignment:
| Q |
1 |
aacactctaactaatatataatagcataaaattacaacaacaattcaattcctcaagatattatactcgttcctctttcatattgctcattttcttcaaa |
100 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30319730 |
aacactctaacta----ataatagcataaaattacaacaacaattcaattcctcaagatattatactcgttcctctttcatattgctcattttcttcaaa |
30319635 |
T |
|
| Q |
101 |
tgactttggtttgttcctagacttggaagatggagattcatactccatattaggatctgatgattgttgtgctttggatctcaatttggatgatgatcca |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30319634 |
tgactttggtttgttcctagacttggaagatggagattcatactccaaattaggatctgatgattgttgtgctttggatctcaatttggatgatgatcca |
30319535 |
T |
|
| Q |
201 |
ccacctgaattttctttatctttcgacttcttcc |
234 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| |
|
|
| T |
30319534 |
ccacctgaattttctttatcttttgacttcttcc |
30319501 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1138 times since January 2019
Visitors: 3663