View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0529_low_57 (Length: 273)
Name: NF0529_low_57
Description: NF0529
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0529_low_57 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 30 - 262
Target Start/End: Original strand, 34684156 - 34684388
Alignment:
| Q |
30 |
caaattaattaattatgtgaaacaaccaaacaagcgtagaaatgagagaagttaagaatacgaacgttaataaaacgctgacaaaatctgaaggggaagt |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34684156 |
caaattaattaattatgtgaaacaaccaaacaagcgtagaaatgagagaagttaagaatacgaacgttaataaaacgctgacaaaatctgaaggggaagt |
34684255 |
T |
|
| Q |
130 |
ggctgtagaactaagcctgcagaagatagaaataacaatatcatctggtagagactcnnnnnnntcataatttgttgtggnnnnnnnctcggaacatttc |
229 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||| ||| |
|
|
| T |
34684256 |
ggctgtagaactaagcctgcagaagatagaaataacaatatcatctggtagagactcaaaaaaatcataatttgttgtggtttttttctcggaacacttc |
34684355 |
T |
|
| Q |
230 |
ttatgcctctttgcacaaaaaagagtgtctctg |
262 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
34684356 |
ttatgcctctttgcacaaaaaagagtgtctctg |
34684388 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 310 times since January 2019
Visitors: 3649