View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0529_low_58 (Length: 272)

Name: NF0529_low_58
Description: NF0529
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0529_low_58
NF0529_low_58
[»] chr7 (2 HSPs)
chr7 (31-104)||(40611686-40611759)
chr7 (178-232)||(40611558-40611612)
[»] chr1 (1 HSPs)
chr1 (185-233)||(28707655-28707703)


Alignment Details
Target: chr7 (Bit Score: 70; Significance: 1e-31; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 31 - 104
Target Start/End: Complemental strand, 40611759 - 40611686
Alignment:
31 aagaatataatggggaagaagggaaattggttttctacagtgaagaaagctctcagccctgactcaaaggtatc 104  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40611759 aagaagataatggggaagaagggaaattggttttctacagtgaagaaagctctcagccctgactcaaaggtatc 40611686  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 178 - 232
Target Start/End: Complemental strand, 40611612 - 40611558
Alignment:
178 gttgtttcagaaatcaagtaaatcaaaaaagaaatggtttgggaagcaaaaattg 232  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40611612 gttgtttcagaaatcaagtaaatcaaaaaagaaatggtttgggaagcaaaaattg 40611558  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 185 - 233
Target Start/End: Original strand, 28707655 - 28707703
Alignment:
185 cagaaatcaagtaaatcaaaaaagaaatggtttgggaagcaaaaattga 233  Q
    ||||| ||||||  |||||| |||||||||||||||||| |||||||||    
28707655 cagaattcaagtggatcaaagaagaaatggtttgggaagaaaaaattga 28707703  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University