View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0529_low_61 (Length: 265)

Name: NF0529_low_61
Description: NF0529
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0529_low_61
NF0529_low_61
[»] chr2 (1 HSPs)
chr2 (1-224)||(15059320-15059543)


Alignment Details
Target: chr2 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 15059320 - 15059543
Alignment:
1 tatattgctaatgcttcataattgagtacttataaaatgacttatagaattcgaggttttctactctttctaaaatgacttcataattgaggtctatagg 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||    
15059320 tatattgctaatgcttcataattgagtacttataaaatgacttatagaattcgaggttttctactctttctaaaatgacttcataattgacgtctatagg 15059419  T
101 tgtatgcttctatggattttatcccctactgtcctgtaaatctaatgtccatgtcttgatactagaaagagtagaaacatggcactgatcgtcacaaata 200  Q
    ||||||||||||||||| ||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
15059420 tgtatgcttctatggatcttatccccttctgtactgtaaatctaatgtccatgtcttgatactagaaagagtagaaacatggcactgatcgtcacaaata 15059519  T
201 atttgtatgattaaaacaaagctt 224  Q
    ||||||||||||||||||||||||    
15059520 atttgtatgattaaaacaaagctt 15059543  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 30 times since January 2019
Visitors: 3646