View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0529_low_61 (Length: 265)
Name: NF0529_low_61
Description: NF0529
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0529_low_61 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 15059320 - 15059543
Alignment:
Q |
1 |
tatattgctaatgcttcataattgagtacttataaaatgacttatagaattcgaggttttctactctttctaaaatgacttcataattgaggtctatagg |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
T |
15059320 |
tatattgctaatgcttcataattgagtacttataaaatgacttatagaattcgaggttttctactctttctaaaatgacttcataattgacgtctatagg |
15059419 |
T |
 |
Q |
101 |
tgtatgcttctatggattttatcccctactgtcctgtaaatctaatgtccatgtcttgatactagaaagagtagaaacatggcactgatcgtcacaaata |
200 |
Q |
|
|
||||||||||||||||| ||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
15059420 |
tgtatgcttctatggatcttatccccttctgtactgtaaatctaatgtccatgtcttgatactagaaagagtagaaacatggcactgatcgtcacaaata |
15059519 |
T |
 |
Q |
201 |
atttgtatgattaaaacaaagctt |
224 |
Q |
|
|
|||||||||||||||||||||||| |
|
|
T |
15059520 |
atttgtatgattaaaacaaagctt |
15059543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University