View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0529_low_64 (Length: 261)
Name: NF0529_low_64
Description: NF0529
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0529_low_64 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 30 - 261
Target Start/End: Original strand, 3293591 - 3293825
Alignment:
| Q |
30 |
aaacaaacccgaaagatcaaatcccgaagacatggatgaaataaactcgaatgcattgaaaaattgcggcgttgagttaatcaaattcacctttgaatcc |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
3293591 |
aaacaaacccgaaagatcaaatcccgaagacatggatgaaataaactcgaatgcattgaaaaattgcggcgttgagttaatcaaattcacctttgattcc |
3293690 |
T |
 |
| Q |
130 |
aactccaaatcatcattt---gtagtagttgttgataaacataaacctttctgaaaccatggaacattcatgattgaagaaatagtgattcttctttcag |
226 |
Q |
| |
|
||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3293691 |
aactcgaaatcatcatttgcagtagtagttgttgataaacataaacctttctgaaaccatggaacattcatgattgaagaaatagtgattcttctttcag |
3293790 |
T |
 |
| Q |
227 |
gatctgccacaagaatcttcgagattaatctcttt |
261 |
Q |
| |
|
|||| |||||||||||||| ||||||||||||||| |
|
|
| T |
3293791 |
gatccgccacaagaatcttagagattaatctcttt |
3293825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University