View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0529_low_65 (Length: 259)
Name: NF0529_low_65
Description: NF0529
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0529_low_65 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 230
Target Start/End: Complemental strand, 42873194 - 42872955
Alignment:
| Q |
1 |
ttcttagacatgcctcatgattatgcatatcctgactagttaacaaaaggaatattgaactagagaaaattaa----------tagttcccgcaccactg |
90 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
42873194 |
ttcttagacatgcctcatgattatgcatatcctgactagttaacaaaaggaatattgaactagagaaaattaaagaaaattaatagttcccgcaccactg |
42873095 |
T |
|
| Q |
91 |
tttggtaactcagagatgccaccacatgatggcttcagaaagagatccttggctccattggtttattaatcaatcaaaccaaattgctttaaacgcaaaa |
190 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42873094 |
tttggtaactcagagatgccaccacatgatggcttcagaaagagatccttggctccattggtttattaatcaatcaaaccaaattgctttaaacgcaaaa |
42872995 |
T |
|
| Q |
191 |
tatggatatacttataataatgcatatgaaaccacaaatt |
230 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42872994 |
tctggatatacttataataatgcatatgaaaccacaaatt |
42872955 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 267 times since January 2019
Visitors: 3649