View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0529_low_65 (Length: 259)

Name: NF0529_low_65
Description: NF0529
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0529_low_65
NF0529_low_65
[»] chr3 (1 HSPs)
chr3 (1-230)||(42872955-42873194)


Alignment Details
Target: chr3 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 230
Target Start/End: Complemental strand, 42873194 - 42872955
Alignment:
1 ttcttagacatgcctcatgattatgcatatcctgactagttaacaaaaggaatattgaactagagaaaattaa----------tagttcccgcaccactg 90  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||          |||||||||||||||||    
42873194 ttcttagacatgcctcatgattatgcatatcctgactagttaacaaaaggaatattgaactagagaaaattaaagaaaattaatagttcccgcaccactg 42873095  T
91 tttggtaactcagagatgccaccacatgatggcttcagaaagagatccttggctccattggtttattaatcaatcaaaccaaattgctttaaacgcaaaa 190  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42873094 tttggtaactcagagatgccaccacatgatggcttcagaaagagatccttggctccattggtttattaatcaatcaaaccaaattgctttaaacgcaaaa 42872995  T
191 tatggatatacttataataatgcatatgaaaccacaaatt 230  Q
    | ||||||||||||||||||||||||||||||||||||||    
42872994 tctggatatacttataataatgcatatgaaaccacaaatt 42872955  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University