View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0529_low_72 (Length: 251)
Name: NF0529_low_72
Description: NF0529
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0529_low_72 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 4 - 243
Target Start/End: Complemental strand, 50274437 - 50274198
Alignment:
| Q |
4 |
agagctatctgtttcccacaaatagaattttcttgtaggttttgttgcattgttataattgtaaattgacctgtttgaaccatcatttgtaacatcaatg |
103 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50274437 |
agagctatctgtttcccacaaatagaattttcttgtaggttttgttgcattgttataattgtaaattgacctgtttgaaccatcatttgtaacatcaatt |
50274338 |
T |
|
| Q |
104 |
tgtttgaaactattggtttcaactaaatcttcattgtcttcttcagatgtcaatagcagaatctgcctcttaatctcatcatagaaagtatcatcttcgt |
203 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50274337 |
tgtctgaaactattggtttcaactaaatcttcattgtcttcttcagatgtcaatagcagaatctgcctcttaatctcatcatagaaagtatcatcttcgt |
50274238 |
T |
|
| Q |
204 |
tttctgtctcaaaccaaacactagcatctgaattcatctc |
243 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
50274237 |
tttctgtctcaaaccaaacactagaatctgaattcatctc |
50274198 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 4 - 243
Target Start/End: Original strand, 14462751 - 14462987
Alignment:
| Q |
4 |
agagctatctgtttcccacaaatagaattttcttgtaggttttgttgcattgttataattgtaaattgacctgtttgaaccatcatttgtaacatcaatg |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14462751 |
agagctatctgtttcccacaaatagaattttcttgtagcttttgttgcattgttataattgtaaattgacctgtttgaaccatcatttgtaacatcaatg |
14462850 |
T |
|
| Q |
104 |
tgtttgaaactattggtttcaactaaatcttcattgtcttcttcagatgtcaatagcagaatctgcctcttaatctcatcatagaaagtatcatcttcgt |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
14462851 |
tgtttgaaactattggtttcaactaaatcttcattg---tcttcagatgtcaatagcagaatctacctcttaatctcatcatagaaagtatcatcttcgt |
14462947 |
T |
|
| Q |
204 |
tttctgtctcaaaccaaacactagcatctgaattcatctc |
243 |
Q |
| |
|
||||||||||||| |||||||||| ||||||||||||||| |
|
|
| T |
14462948 |
tttctgtctcaaatcaaacactagaatctgaattcatctc |
14462987 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 252 times since January 2019
Visitors: 3648