View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0529_low_75 (Length: 251)
Name: NF0529_low_75
Description: NF0529
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0529_low_75 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 125; Significance: 2e-64; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 108 - 239
Target Start/End: Original strand, 30319853 - 30319985
Alignment:
Q |
108 |
aaatagaaagtctt-gtattatttacccattgctgatatgtaatttactaactagtgcaacttgttcactttagttttcattgatttgtttaagataaat |
206 |
Q |
|
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
30319853 |
aaatagaaagtctttgtattatttacccattgctgatatgtaatttactaactagtgcaacttgttcactttagttttcattgatttgtttaagataaat |
30319952 |
T |
 |
Q |
207 |
tgcaaatgttgaagaattctacgtaggtgttca |
239 |
Q |
|
|
||||||||||||||||||||||||||||||||| |
|
|
T |
30319953 |
tgcaaatgttgaagaattctacgtaggtgttca |
30319985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 1 - 51
Target Start/End: Original strand, 30319732 - 30319782
Alignment:
Q |
1 |
cattgcatagatataattcttaaaaactagaacactttccttcctaaccat |
51 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
30319732 |
cattgcatagatataattcttaaaaactagaacactttccttcctaaccat |
30319782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University