View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0529_low_89 (Length: 231)

Name: NF0529_low_89
Description: NF0529
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0529_low_89
NF0529_low_89
[»] chr2 (1 HSPs)
chr2 (19-127)||(16309871-16309979)


Alignment Details
Target: chr2 (Bit Score: 109; Significance: 6e-55; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 19 - 127
Target Start/End: Original strand, 16309871 - 16309979
Alignment:
19 tatgagtattgacgtggcaatatattaccggatacatgtataaaaaataattgtattaattaattaaatatgcgtcacaatatacatacatttggaatga 118  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
16309871 tatgagtattgacgtggcaatatattaccggatacatgtataaaaaataattgtattaattaattaaatatgcgtcacaatatacatacatttggaatga 16309970  T
119 tattgaggt 127  Q
    |||||||||    
16309971 tattgaggt 16309979  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 462 times since January 2019
Visitors: 3651