View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0529_low_9 (Length: 526)
Name: NF0529_low_9
Description: NF0529
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0529_low_9 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 209; Significance: 1e-114; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 183 - 399
Target Start/End: Original strand, 457061 - 457277
Alignment:
| Q |
183 |
taactaattaccatcgtggatttgttcagtggagtgaggacacagagctagttactaaggttatcatttatcaaggagatcgattgggtggattcggtct |
282 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
457061 |
taactaattaccatcgtggatttgttcagtggagtgaggacacagagcttgttactaaggttatcatttatcaaggagatcgattgggtggattcggtct |
457160 |
T |
|
| Q |
283 |
agagataggtaaataaaacaaaactgaactcatgaaaatagcttatgaccatgccataagccattttcacaacttctctatactagtatctcaaacgttt |
382 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
457161 |
agagataggtaaataaaacaaaactgaactcatgaaaatagcttatgaccatgccataagccattttcacaacgtctctatactagtatctcaaacgttt |
457260 |
T |
|
| Q |
383 |
atgttaatgcgaaagtt |
399 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
457261 |
atgttaatgcgaaagtt |
457277 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 458 - 502
Target Start/End: Original strand, 457336 - 457380
Alignment:
| Q |
458 |
tgttaagaaagaaacacaatttgatttgatataaccttaccctat |
502 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
457336 |
tgttaaaaaagaaacacaatttgatttgatataaccttaccctat |
457380 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 103 - 142
Target Start/End: Original strand, 456982 - 457021
Alignment:
| Q |
103 |
acttcaaaagtgtgttcaaaatgtggggggagctacctac |
142 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
456982 |
acttcaaaagtgtgttcaaaatgtggggggagctacctac |
457021 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 154 times since January 2019
Visitors: 3647