View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0529_low_91 (Length: 212)
Name: NF0529_low_91
Description: NF0529
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0529_low_91 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 65; Significance: 9e-29; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 65; E-Value: 9e-29
Query Start/End: Original strand, 6 - 78
Target Start/End: Complemental strand, 40964662 - 40964590
Alignment:
Q |
6 |
ttaactcctttttatctttattcataatattgttgagttgaatgtttatcattgtccctaatatacctatgat |
78 |
Q |
|
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||| |
|
|
T |
40964662 |
ttaactcctttttatctttattcataattttgttgagttgaatgtttatcattgtccctaatatacctttgat |
40964590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University