View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0529_low_94 (Length: 211)
Name: NF0529_low_94
Description: NF0529
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0529_low_94 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 54; Significance: 3e-22; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 20 - 108
Target Start/End: Original strand, 15085774 - 15085865
Alignment:
| Q |
20 |
aacgttacaaagtagaagaaagaaagaaagnnnnnnnn---gtgcggtggcgttaagttcttttcttcccccgaaattcacacaacacaaca |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15085774 |
aacgttacaaagtagaagaaagaaagaaagaaagaaaaaaagtgcggtggcgttaagttcttttcttcccccgaaattcacacaacacaaca |
15085865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University