View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0529_low_95 (Length: 210)

Name: NF0529_low_95
Description: NF0529
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0529_low_95
NF0529_low_95
[»] chr2 (1 HSPs)
chr2 (1-123)||(38995593-38995715)


Alignment Details
Target: chr2 (Bit Score: 99; Significance: 5e-49; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 1 - 123
Target Start/End: Original strand, 38995593 - 38995715
Alignment:
1 aagaacacaacataatttctcaaacctttaacataaaaatggaaatcaaagttttaagatgaaacctnnnnnnnntatggagctaaaacataaagaaaaa 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||        |||||||||||||||||||||||||    
38995593 aagaacacaacataatttctcaaacctttaacataaaaatggaaatcaaagttttaagatgaaacctaaaaaaaatatggagctaaaacataaagaaaaa 38995692  T
101 gaagaatccccatcatccacaca 123  Q
    |||||||||||||||||||||||    
38995693 gaagaatccccatcatccacaca 38995715  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University