View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0529_low_97 (Length: 206)
Name: NF0529_low_97
Description: NF0529
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0529_low_97 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 14 - 185
Target Start/End: Complemental strand, 56200132 - 56199961
Alignment:
Q |
14 |
catcatcaatgactgcactgctgatcttcttgaaaagttcataaagtgcttcaatctcacttacactaaacacggtctctcttgcaagaagttgtggatt |
113 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
56200132 |
catcatcaatgactgcactgctgatcttcttgaaaagttcataaagtgcttcaatctcacttacactaaacacggtctctcttgcaagaagttgtggatt |
56200033 |
T |
 |
Q |
114 |
ttgtaaaccaataggttgttgatttaacgaatcagaatcgcaacaatttacgacagaagcacacaaatgctt |
185 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
T |
56200032 |
ttgtaaaccaataggttgttgatttaacgaatcagaatcgcaacaatttatgacagaagcacacaaatgctt |
56199961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 14 - 82
Target Start/End: Complemental strand, 42160901 - 42160833
Alignment:
Q |
14 |
catcatcaatgactgcactgctgatcttcttgaaaagttcataaagtgcttcaatctcacttacactaa |
82 |
Q |
|
|
|||||||||| || |||||||||||||| || || || |||||||| |||||||| ||||||||||||| |
|
|
T |
42160901 |
catcatcaatcaccgcactgctgatctttttaaagagctcataaagagcttcaatttcacttacactaa |
42160833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 14 - 80
Target Start/End: Complemental strand, 24091652 - 24091586
Alignment:
Q |
14 |
catcatcaatgactgcactgctgatcttcttgaaaagttcataaagtgcttcaatctcacttacact |
80 |
Q |
|
|
|||||||||| || |||||||||||||| ||||| || ||||| |||||||| || ||||| ||||| |
|
|
T |
24091652 |
catcatcaattacagcactgctgatctttttgaagagctcatacagtgcttctatttcactaacact |
24091586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 55 times since January 2019
Visitors: 3646