View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0529_low_98 (Length: 204)
Name: NF0529_low_98
Description: NF0529
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0529_low_98 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 116; Significance: 3e-59; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 116; E-Value: 3e-59
Query Start/End: Original strand, 25 - 181
Target Start/End: Original strand, 850692 - 850846
Alignment:
Q |
25 |
tatgttgcgtgaagagcataattcaaatgctcattggctcaactcctatctcagcttaacccaatctatgacataaagtttcacacaacctcgttaccac |
124 |
Q |
|
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
850692 |
tatgttgggtgaagagcataattcaaatgctcattggctcaactcctatctcagcctaacccaatctatgacataaagtttcacacaacctcgttaccac |
850791 |
T |
 |
Q |
125 |
aaaaaccttaaaccttacaacaacnnnnnnncatggaaaactactctgtttcttctc |
181 |
Q |
|
|
|||||||||||||||||||| || |||||||||||||||||||||||||| |
|
|
T |
850792 |
aaaaaccttaaaccttacaaaaa--aaaaaacatggaaaactactctgtttcttctc |
850846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 335 times since January 2019
Visitors: 3649