View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0532-Insertion-10 (Length: 88)
Name: NF0532-Insertion-10
Description: NF0532
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0532-Insertion-10 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 67; Significance: 2e-30; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 67; E-Value: 2e-30
Query Start/End: Original strand, 7 - 85
Target Start/End: Original strand, 39128397 - 39128475
Alignment:
| Q |
7 |
agtaaatgtttgttttatttttgttagtgagagggtttcaaaaccattttatgctttgtgtcaatacaatggtagcact |
85 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||| |||| |
|
|
| T |
39128397 |
agtaaatgtttgttttatttttgttagtgagagggtttcaaaaccattttatgctctgtgtcaatacaatagtatcact |
39128475 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1226 times since January 2019
Visitors: 3642