View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0532-Insertion-2 (Length: 532)
Name: NF0532-Insertion-2
Description: NF0532
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0532-Insertion-2 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 266; Significance: 1e-148; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 266; E-Value: 1e-148
Query Start/End: Original strand, 6 - 377
Target Start/End: Complemental strand, 27816077 - 27815706
Alignment:
| Q |
6 |
cacctcagggtcagatcgtcggagggtttgtcgtcggtccgttgcttgccgccggtacggtgtttgtcattgctgcttcctttaacaatccgtcttatca |
105 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
27816077 |
cacctcagggtcagatcgttggagggtttgtcgtcggtccgttgcttgccgccggtacggtgtttgtcattgctgcttcctttaacaatccttcttatca |
27815978 |
T |
 |
| Q |
106 |
taggttgcctttagaagaggatgtgaggaataactcagtctccggcggctgtgaagagaagtcgccgccgcagttttctggtggagagtcgtgtatgtat |
205 |
Q |
| |
|
||| || ||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
27815977 |
tagattacctttggaagaggatgtgaggaataactcagtctccggcggctatgaagagaagtcgccgccgcagctttctggtggagagtcgtgtatgtat |
27815878 |
T |
 |
| Q |
206 |
agctctcagcttccttctgatgtgatttgggctccaacggcaagaacaaatttctgatatattattatcatcactttttgttgacannnnnnnngtagtt |
305 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| | |||||| |
|
|
| T |
27815877 |
agctctcagcttccttctgatgtgatttgggctccaacggcaagaacaaatttctgatatatta--atcatcactttttgttgatattttttttgtagtt |
27815780 |
T |
 |
| Q |
306 |
gtagtatgagtgtggc--nnnnnnnnnnctttgttcttcatggtttgggtgtaacgttttctaggaagattggt |
377 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27815779 |
gtagtatgagtgtggcttttttttttttctttgttcttcatggtttgggtgtaacgttttctaggaagattggt |
27815706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 475 - 532
Target Start/End: Complemental strand, 27815608 - 27815551
Alignment:
| Q |
475 |
ttaagaagaaaagcacaacttgacatgcttttctttattaagagaagtcagtccatgc |
532 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||| || |||||||||||||| |
|
|
| T |
27815608 |
ttaagaagaaaagcacaacttgacatgcttttcttttttacgaaaagtcagtccatgc |
27815551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 35; Significance: 0.0000000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 62 - 128
Target Start/End: Original strand, 46201307 - 46201373
Alignment:
| Q |
62 |
acggtgtttgtcattgctgcttcctttaacaatccgtcttatcataggttgcctttagaagaggatg |
128 |
Q |
| |
|
||||||||||| |||||| |||| ||||| |||||||| |||||||||||||| || ||||| |||| |
|
|
| T |
46201307 |
acggtgtttgtgattgcttcttcgtttaataatccgtcgtatcataggttgccgttggaagaagatg |
46201373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University